Date of Award

Summer 8-2017

Document Type

Thesis

Degree Name

Master of Science (MS)

Department

Biology

First Advisor

Narayanaswamy Bharathan

Second Advisor

Seema Bharathan

Third Advisor

Robert Major

Abstract

Rhizoctonia solani is a soil-borne plant pathogenic fungus that is classified into fourteen different anastomosis groups (AG's). Isolates of R. solani from each group are genetically isolated and have distinct host-range. This study includes two parts, which is specifically for AG4. The first part is four isolates with specific phenotypic and genotypic characters were compared. The isolate Rhs29 is a heterokaryon (wild-type) that contains Middle (M)-size double-stranded (ds) RNA, which is mycoviral and cytoplasmic in origin. The protein profiles of this isolate was compared to three other isolates: Rhs29.5, Rhs29.6, and Rhs29.7, which are homokaryons (mutant), and do not possessany viral infection. The virus was partially purified following high-speed centrifugal pelleting and sucrose density gradient from Rhs29 that compared to total proteins from Rhs29 and Rhs29.7 isolates. Protein profiles were compared by Agilent protein chip and Two-Dimensional Difference Gel Electrophoresis (2D-DIGE) analysis. Preliminary data from the two tests shows the presence of unique polypeptides in the wild type isolate and not in mutant isolates. These polypeptides vary in sizes from 15-50 kilo Daltons (kDa). Some of the sequences of these polypeptides may be associated with the coat-protein of the virus. The second part is dsRNA from Rhs29 was cloned into a pJET cloning vector. The clones were randomly selected and underwent plasmid purification followed by fast digestion with ECOR1. The plasmid profiles were analyzed by agarose gel electrophoresis. Clones were sequenced by Retrogen Inc. and by using a bioinformatics software tool to design the primers. The forward and reverse primer sequences were TTCCTCCTGGAGCAGTCAATC and GGCGCTGAGGTAGAGTTGATC. The primers and probes for qPCR assays were designed from cloned dsRNA fragments of the wild-type dsRNA. Then hybridized to dsRNA from cloned DNA and the other wild-type and RC strains of R. solani. Probes were dual labeled (5’FAM/3’BHQ-1) and the design for the qPCR assays was done using Biosearch Technologies (Novato, CA) Real Time Design™ software. The probe sequences were CCGTACCCGGCAGACTGTTTCTA.

Included in

Biology Commons

Share

COinS